Skip to main content

Table 1 Sequences of Forward and reverse primers for real-time PCR

From: SiRNA-mediated ankyrin-G silence modulates the expression of voltage-gated Na channels in murine hippocampal HT22 cells

Target genes Forward sequences(5′-3′) Reverse sequences(5′-3′)
MZ-Ank3 GGCCTTACCCCAATCCATGTT TCCTTAGCTTTTGCTTCTACCTG
MZ-Scn8a GCAAGCTCAAGAAACCACCC CCGTAGATGAAAGGCAAACTCT
MZ-Scn1a TCAGAGGGAAGCACAGTAGAC TTCCACGCTGATTTGACAGCA
MZ-GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA